Back to Home
Completeness: Estimated viral genome completeness from CheckV analysis
Contamination: Estimated viral genome contamination from CheckV analysis
Viral-HI(min): Minimum viral HI score
Prediction Results
Results include prediction quality assessment, CheckV completeness/contamination metrics, and SOS box location information
| host | virus | prediction_result | prediction_quality | completeness | contamination | viral-HI(min) | box-seq | box-seq_start_pos | box-seq_strand | confidence_window_lower | confidence_window_upper | blast_status | fimo_status |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| wp2.fna | sp1 | SiP (SOS-independent Prophage) | High | 100.0 | 0.0 | 14.2017 | CACTGTATTATTATACCACA | 29652 | - | 11.8522 | 13.3752 | Blast_OK | Fimo_OK |
| wp2.fna | sp2 | SdP (SOS-dependent Prophage) | High | 100.0 | 0.0 | 11.7239 | TTATGTATGTATATTCAGCA | 17757 | - | 11.8522 | 13.3752 | Blast_OK | Fimo_OK |
| wp2.fna | sp3 | SiP (SOS-independent Prophage) | High | 99.62 | 0.0 | 15.4715 | CACTGTATAAAAAAACATAC | 1225 | - | 11.8522 | 13.3752 | Blast_OK | Fimo_OK |
Results explanation
Prediction Quality
- High: viral completeness 90%-100%
- Medium: viral completeness 50-90%
- Low: viral completeness < 50%
SOS Box Information
- box-seq: SOS box sequence motif
- box-seq_start_pos: box start position in viral genome
- box-seq strand: + (forward) or - (reverse)
Quality Metrics